Transcript: Human XM_017018559.2

PREDICTED: Homo sapiens zw10 kinetochore protein (ZW10), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZW10 (9183)
Length:
2900
CDS:
710..2389

Additional Resources:

NCBI RefSeq record:
XM_017018559.2
NBCI Gene record:
ZW10 (9183)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018559.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000331061 CACGTATCAACCGGTGAATTT pLKO_005 289 5UTR 100% 13.200 18.480 N ZW10 n/a
2 TRCN0000158339 CCATCCCTTCATGCTGTGATA pLKO.1 827 CDS 100% 4.950 3.960 N ZW10 n/a
3 TRCN0000331058 CCATCCCTTCATGCTGTGATA pLKO_005 827 CDS 100% 4.950 3.960 N ZW10 n/a
4 TRCN0000155335 GAGATCATACAGTCCACTGAA pLKO.1 1136 CDS 100% 4.950 3.465 N ZW10 n/a
5 TRCN0000331059 GAGATCATACAGTCCACTGAA pLKO_005 1136 CDS 100% 4.950 3.465 N ZW10 n/a
6 TRCN0000150938 GCCATTCAAGGAATTGATGAT pLKO.1 2212 CDS 100% 4.950 3.465 N ZW10 n/a
7 TRCN0000330994 GCCATTCAAGGAATTGATGAT pLKO_005 2212 CDS 100% 4.950 3.465 N ZW10 n/a
8 TRCN0000151692 CCATGATGTTGTACCAACATA pLKO.1 1606 CDS 100% 0.563 0.394 N ZW10 n/a
9 TRCN0000154601 GAAGACATTGACCTGCTGAAA pLKO.1 235 5UTR 100% 4.950 2.970 N ZW10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018559.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.