Transcript: Human XM_017018572.1

PREDICTED: Homo sapiens neurexin 2 (NRXN2), transcript variant X21, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NRXN2 (9379)
Length:
5480
CDS:
16..4458

Additional Resources:

NCBI RefSeq record:
XM_017018572.1
NBCI Gene record:
NRXN2 (9379)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018572.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139408 CCATAGTAAGCGACGGCAAAT pLKO.1 2972 CDS 100% 10.800 15.120 N NRXN2 n/a
2 TRCN0000433582 CCTCAAGGACGTGGTCTATAA pLKO_005 660 CDS 100% 13.200 10.560 N NRXN2 n/a
3 TRCN0000446907 CTCACAGCCCTGGGTTGATTT pLKO_005 4713 3UTR 100% 13.200 10.560 N NRXN2 n/a
4 TRCN0000139335 CCACTGCTCGTCCTGTTAATT pLKO.1 4805 3UTR 100% 15.000 10.500 N NRXN2 n/a
5 TRCN0000094487 CCCGGCAGGAAACTTTGATAA pLKO.1 3069 CDS 100% 13.200 9.240 N Nrxn2 n/a
6 TRCN0000140984 CAATGGCAAGTTCAACGACAA pLKO.1 402 CDS 100% 4.050 2.835 N NRXN2 n/a
7 TRCN0000139375 CGACCTTCAAAGGCAATGAGT pLKO.1 179 CDS 100% 3.000 2.100 N NRXN2 n/a
8 TRCN0000143238 GAAGAACAAAGACAAGGAGTA pLKO.1 4428 CDS 100% 4.050 2.430 N NRXN2 n/a
9 TRCN0000140179 GCACCTCTTCTTCCAGTTCAA pLKO.1 2139 CDS 100% 4.950 2.475 Y NRXN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018572.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.