Transcript: Human XM_017018585.2

PREDICTED: Homo sapiens CD44 molecule (Indian blood group) (CD44), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD44 (960)
Length:
4417
CDS:
137..1348

Additional Resources:

NCBI RefSeq record:
XM_017018585.2
NBCI Gene record:
CD44 (960)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018585.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296191 GGACCAATTACCATAACTATT pLKO_005 557 CDS 100% 13.200 18.480 N CD44 n/a
2 TRCN0000308110 CCGTTGGAAACATAACCATTA pLKO_005 1379 3UTR 100% 10.800 15.120 N CD44 n/a
3 TRCN0000057564 CCTCCCAGTATGACACATATT pLKO.1 468 CDS 100% 13.200 10.560 N CD44 n/a
4 TRCN0000289233 CCTCCCAGTATGACACATATT pLKO_005 468 CDS 100% 13.200 10.560 N CD44 n/a
5 TRCN0000057563 GCCCTATTAGTGATTTCCAAA pLKO.1 2420 3UTR 100% 4.950 3.465 N CD44 n/a
6 TRCN0000057567 CGCTATGTCCAGAAAGGAGAA pLKO.1 596 CDS 100% 4.050 2.835 N CD44 n/a
7 TRCN0000289308 CGCTATGTCCAGAAAGGAGAA pLKO_005 596 CDS 100% 4.050 2.835 N CD44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018585.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05963 pDONR223 100% 57.6% 57.5% None 255C>T;793_794ins888 n/a
2 ccsbBroad304_05963 pLX_304 0% 57.6% 57.5% V5 255C>T;793_794ins888 n/a
Download CSV