Transcript: Human XM_017018691.2

PREDICTED: Homo sapiens importin 8 (IPO8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IPO8 (10526)
Length:
5239
CDS:
298..3360

Additional Resources:

NCBI RefSeq record:
XM_017018691.2
NBCI Gene record:
IPO8 (10526)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018691.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156712 GCTCGGCTCTTTGAACGATAT pLKO.1 1054 CDS 100% 10.800 15.120 N IPO8 n/a
2 TRCN0000155819 CCACTCTTCGTTCAACTTGTT pLKO.1 2521 CDS 100% 4.950 6.930 N IPO8 n/a
3 TRCN0000151987 CCTCGTATTCAGCAACAAATT pLKO.1 784 CDS 100% 13.200 9.240 N IPO8 n/a
4 TRCN0000155943 CCTTCCTGATTCCTCCTATTA pLKO.1 813 CDS 100% 13.200 9.240 N IPO8 n/a
5 TRCN0000156560 GCGAAGAAGAGCCTGATTGAA pLKO.1 1750 CDS 100% 5.625 3.938 N IPO8 n/a
6 TRCN0000150605 GCAAGCATTCAACTATCTCAA pLKO.1 1218 CDS 100% 4.950 3.465 N IPO8 n/a
7 TRCN0000156852 GCCTTGTACTACAACCCTGAT pLKO.1 2611 CDS 100% 4.050 2.835 N IPO8 n/a
8 TRCN0000155225 GCAGAGAAAGCTGATATGGAA pLKO.1 2914 CDS 100% 3.000 2.100 N IPO8 n/a
9 TRCN0000155429 CCAGATTTAGTGAGAGTCCAA pLKO.1 556 CDS 100% 2.640 1.848 N IPO8 n/a
10 TRCN0000156073 CGGATTATAGTCTCTGACCAT pLKO.1 367 CDS 100% 2.640 1.848 N IPO8 n/a
11 TRCN0000092942 GAAGATGAGGAGGAGGAAGAA pLKO.1 3013 CDS 100% 4.950 2.475 Y Gm13232 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018691.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.