Transcript: Human XM_017018785.2

PREDICTED: Homo sapiens DEP domain containing 4 (DEPDC4), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DEPDC4 (120863)
Length:
1292
CDS:
209..1210

Additional Resources:

NCBI RefSeq record:
XM_017018785.2
NBCI Gene record:
DEPDC4 (120863)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134235 GTTATCACTAACACTTGCCTA pLKO.1 1148 CDS 100% 2.640 3.696 N DEPDC4 n/a
2 TRCN0000412889 TATGTCTTCTTCAATTGATTC pLKO_005 1050 CDS 100% 10.800 8.640 N DEPDC4 n/a
3 TRCN0000137581 CTTGTCAGTCAGAACGAGCTT pLKO.1 353 CDS 100% 2.640 2.112 N DEPDC4 n/a
4 TRCN0000426591 TCCAGCTTTATGTCCAAATAT pLKO_005 928 CDS 100% 15.000 10.500 N DEPDC4 n/a
5 TRCN0000133752 CTACAGGTTTCTAGGCAATAA pLKO.1 757 CDS 100% 13.200 9.240 N DEPDC4 n/a
6 TRCN0000417106 GAAGATCTTGTTATCACTAAC pLKO_005 1139 CDS 100% 10.800 7.560 N DEPDC4 n/a
7 TRCN0000135753 CCAAGCTTATGTCTACCTGAA pLKO.1 1184 CDS 100% 4.050 2.835 N DEPDC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.