Transcript: Human XM_017018796.1

PREDICTED: Homo sapiens chromosome 12 open reading frame 54 (C12orf54), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C12orf54 (121273)
Length:
1604
CDS:
952..1353

Additional Resources:

NCBI RefSeq record:
XM_017018796.1
NBCI Gene record:
C12orf54 (121273)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018796.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163806 GCACATCCATAGAAGAGACAA pLKO.1 1034 CDS 100% 4.950 6.930 N C12orf54 n/a
2 TRCN0000162717 CATCCATAGAAGAGACAATGA pLKO.1 1037 CDS 100% 4.950 3.465 N C12orf54 n/a
3 TRCN0000159407 GAAGATATTAGCAGACATCAT pLKO.1 1410 3UTR 100% 4.950 3.465 N C12orf54 n/a
4 TRCN0000165195 GAAGCATAAGGCCTCCAGATT pLKO.1 1211 CDS 100% 4.950 3.465 N C12orf54 n/a
5 TRCN0000166583 CAACCTGAAGACACAGCTCTT pLKO.1 1302 CDS 100% 4.050 2.835 N C12orf54 n/a
6 TRCN0000166448 CATAAGGCCTCCAGATTCCTT pLKO.1 1215 CDS 100% 3.000 2.100 N C12orf54 n/a
7 TRCN0000165068 GAGACAATGAGACCACAGGAA pLKO.1 1048 CDS 100% 2.640 1.848 N C12orf54 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018796.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.