Transcript: Human XM_017018970.2

PREDICTED: Homo sapiens myelin regulatory factor like (MYRFL), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYRFL (196446)
Length:
3148
CDS:
439..2955

Additional Resources:

NCBI RefSeq record:
XM_017018970.2
NBCI Gene record:
MYRFL (196446)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018970.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137585 CACCGGATTTAGCTGACTGTT pLKO.1 2864 CDS 100% 4.950 6.930 N MYRFL n/a
2 TRCN0000138374 CACACCCACCAATGTCAAGTT pLKO.1 2637 CDS 100% 4.950 3.465 N MYRFL n/a
3 TRCN0000134830 CAGATTATGGAAATCCAGCAA pLKO.1 2536 CDS 100% 2.640 1.848 N MYRFL n/a
4 TRCN0000138013 GTCTCTTCAAGTCCTGTGCAA pLKO.1 2383 CDS 100% 2.640 1.848 N MYRFL n/a
5 TRCN0000137403 GCAAAGACAATCTGAGGAGAA pLKO.1 2400 CDS 100% 4.050 2.430 N MYRFL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018970.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.