Transcript: Human XM_017019071.1

PREDICTED: Homo sapiens ELKS/RAB6-interacting/CAST family member 1 (ERC1), transcript variant X21, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ERC1 (23085)
Length:
4383
CDS:
382..3528

Additional Resources:

NCBI RefSeq record:
XM_017019071.1
NBCI Gene record:
ERC1 (23085)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154579 GCGGACAATTGAACGCTTAAA pLKO.1 2175 CDS 100% 13.200 18.480 N ERC1 n/a
2 TRCN0000154825 GCTTGAAAGAACGGGTCAAAT pLKO.1 2084 CDS 100% 13.200 18.480 N ERC1 n/a
3 TRCN0000155098 GCTAGTGACACCATAGCATTT pLKO.1 736 CDS 100% 10.800 15.120 N ERC1 n/a
4 TRCN0000155567 CCCTATGTATCTAAGTGACCA pLKO.1 591 CDS 100% 2.640 3.696 N ERC1 n/a
5 TRCN0000150373 CAGGAACTAGAATCCATGAAA pLKO.1 2833 CDS 100% 5.625 3.938 N ERC1 n/a
6 TRCN0000157699 CAGGCCAAAGAGCTGTTTCTT pLKO.1 1210 CDS 100% 5.625 3.938 N ERC1 n/a
7 TRCN0000157836 CCCTAAATGCTCGGGATGAAT pLKO.1 1283 CDS 100% 5.625 3.938 N ERC1 n/a
8 TRCN0000151917 CAAAGCTAGAAACACTCACAA pLKO.1 1757 CDS 100% 4.950 3.465 N ERC1 n/a
9 TRCN0000155302 GCAGAAGTTGATCGACTCTTA pLKO.1 2563 CDS 100% 4.950 3.465 N ERC1 n/a
10 TRCN0000157886 CCAGAGATGAGTGACCGAATA pLKO.1 2488 CDS 100% 10.800 6.480 N ERC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.