Transcript: Human XM_017019081.1

PREDICTED: Homo sapiens cut like homeobox 2 (CUX2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CUX2 (23316)
Length:
6751
CDS:
246..4520

Additional Resources:

NCBI RefSeq record:
XM_017019081.1
NBCI Gene record:
CUX2 (23316)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019081.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021070 CTGAGTGTTTACAAGCAATTA pLKO.1 327 CDS 100% 13.200 18.480 N CUX2 n/a
2 TRCN0000021073 AGGAGCTTAATTCCGTCGCTT pLKO.1 124 5UTR 100% 2.640 3.696 N CUX2 n/a
3 TRCN0000021072 CGGGTAATGATGGACTCCCAA pLKO.1 4066 CDS 100% 2.640 3.696 N CUX2 n/a
4 TRCN0000021071 GCCTACCTGAAACGTCGCTAT pLKO.1 3444 CDS 100% 4.050 3.240 N CUX2 n/a
5 TRCN0000021069 CCTGAAGACTCACTGCTTATT pLKO.1 1230 CDS 100% 13.200 7.920 N CUX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019081.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.