Transcript: Human XM_017019254.1

PREDICTED: Homo sapiens single-pass membrane protein with coiled-coil domains 2 (SMCO2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMCO2 (341346)
Length:
5932
CDS:
348..1142

Additional Resources:

NCBI RefSeq record:
XM_017019254.1
NBCI Gene record:
SMCO2 (341346)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336779 GGACAAGCACTGAGGTGAATA pLKO_005 697 CDS 100% 13.200 18.480 N SMCO2 n/a
2 TRCN0000336780 CATGACCAGGACCTGAGTAAA pLKO_005 369 CDS 100% 13.200 9.240 N SMCO2 n/a
3 TRCN0000336777 TCTCACAGTTCTGAGGAAATA pLKO_005 840 CDS 100% 13.200 9.240 N SMCO2 n/a
4 TRCN0000336781 ACACAGTGAAGAGCTTATTAA pLKO_005 610 CDS 100% 15.000 9.000 N SMCO2 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2814 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2814 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.