Transcript: Human XM_017019269.2

PREDICTED: Homo sapiens inositol 1,4,5-trisphosphate receptor type 2 (ITPR2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITPR2 (3709)
Length:
6181
CDS:
417..5618

Additional Resources:

NCBI RefSeq record:
XM_017019269.2
NBCI Gene record:
ITPR2 (3709)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431806 GGTGAAGACGTGCTGATATTT pLKO_005 4491 CDS 100% 15.000 21.000 N ITPR2 n/a
2 TRCN0000421588 GATTTGGACAGCCAAGTTAAT pLKO_005 5136 CDS 100% 13.200 18.480 N ITPR2 n/a
3 TRCN0000423300 GTCTAATCAAGACGTAGATAA pLKO_005 3779 CDS 100% 13.200 18.480 N ITPR2 n/a
4 TRCN0000061283 GCACAATAACTCAGAATGAAA pLKO.1 1861 CDS 100% 5.625 2.813 Y ITPR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.