Transcript: Human XM_017019532.1

PREDICTED: Homo sapiens tescalcin (TESC), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TESC (54997)
Length:
1015
CDS:
50..805

Additional Resources:

NCBI RefSeq record:
XM_017019532.1
NBCI Gene record:
TESC (54997)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019532.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055810 GCAGCTCCATCGGAGATTTAA pLKO.1 286 CDS 100% 15.000 10.500 N TESC n/a
2 TRCN0000299767 GCAGCTCCATCGGAGATTTAA pLKO_005 286 CDS 100% 15.000 10.500 N TESC n/a
3 TRCN0000055808 CCTGGCTGATGAGATCAATTT pLKO.1 442 CDS 100% 13.200 9.240 N TESC n/a
4 TRCN0000299837 CCTGGCTGATGAGATCAATTT pLKO_005 442 CDS 100% 13.200 9.240 N TESC n/a
5 TRCN0000055809 CGCATCACTCTGGAAGAATAT pLKO.1 593 CDS 100% 13.200 9.240 N TESC n/a
6 TRCN0000299840 CGCATCACTCTGGAAGAATAT pLKO_005 593 CDS 100% 13.200 9.240 N TESC n/a
7 TRCN0000055812 AGTGGAGATCAGCCTACCATT pLKO.1 314 CDS 100% 4.950 3.465 N TESC n/a
8 TRCN0000299838 AGTGGAGATCAGCCTACCATT pLKO_005 314 CDS 100% 4.950 3.465 N TESC n/a
9 TRCN0000055811 CCTGACCATCATGTCCTACTT pLKO.1 472 CDS 100% 4.950 3.465 N TESC n/a
10 TRCN0000299839 CCTGACCATCATGTCCTACTT pLKO_005 472 CDS 100% 4.950 3.465 N TESC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019532.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.