Transcript: Human XM_017019544.2

PREDICTED: Homo sapiens PARP1 binding protein (PARPBP), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PARPBP (55010)
Length:
2468
CDS:
78..971

Additional Resources:

NCBI RefSeq record:
XM_017019544.2
NBCI Gene record:
PARPBP (55010)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431988 CTCCTCCCATTGGCAATTAAA pLKO_005 1536 3UTR 100% 15.000 21.000 N PARPBP n/a
2 TRCN0000432818 AGTAAATACAACCGTGATAAT pLKO_005 546 CDS 100% 13.200 18.480 N PARPBP n/a
3 TRCN0000167915 CCATTCACCAAAGACATGCTT pLKO.1 1279 3UTR 100% 3.000 2.400 N PARPBP n/a
4 TRCN0000167104 CAAACTAGCTAAAGTAGCAAA pLKO.1 1146 3UTR 100% 4.950 3.465 N PARPBP n/a
5 TRCN0000168712 GAGGGTGTAAATCCATCTGTT pLKO.1 898 CDS 100% 4.950 3.465 N PARPBP n/a
6 TRCN0000149356 GCCTGTGTTCTGTAAAGAGAA pLKO.1 2111 3UTR 100% 4.950 2.475 Y PMCHL2 n/a
7 TRCN0000153159 GCCTGTGTTCTGTAAAGAGAA pLKO.1 2111 3UTR 100% 4.950 2.475 Y PMCHL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.