Transcript: Human XM_017019676.2

PREDICTED: Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent 1H (PPM1H), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPM1H (57460)
Length:
2474
CDS:
150..1445

Additional Resources:

NCBI RefSeq record:
XM_017019676.2
NBCI Gene record:
PPM1H (57460)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019676.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336612 ACGAGAGAGGAGTTCATATAA pLKO_005 920 CDS 100% 15.000 21.000 N PPM1H n/a
2 TRCN0000052769 GCAGGGCCATAATCATCAGAA pLKO.1 1015 CDS 100% 4.950 3.960 N PPM1H n/a
3 TRCN0000052772 CCCTCATTGTGATTTGCCTTT pLKO.1 961 CDS 100% 4.050 2.835 N PPM1H n/a
4 TRCN0000331708 CCCTCATTGTGATTTGCCTTT pLKO_005 961 CDS 100% 4.050 2.835 N PPM1H n/a
5 TRCN0000052768 GCTTGGAAAGAAGATGCTCTA pLKO.1 1178 CDS 100% 4.050 2.835 N PPM1H n/a
6 TRCN0000052771 CCCAAACAGGAACTCATCCAA pLKO.1 488 CDS 100% 3.000 2.100 N PPM1H n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019676.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.