Transcript: Human XM_017019871.2

PREDICTED: Homo sapiens caprin family member 2 (CAPRIN2), transcript variant X28, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAPRIN2 (65981)
Length:
3754
CDS:
283..2862

Additional Resources:

NCBI RefSeq record:
XM_017019871.2
NBCI Gene record:
CAPRIN2 (65981)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330759 GTTGAGCCTAGATCTACTAAA pLKO_005 597 CDS 100% 13.200 18.480 N CAPRIN2 n/a
2 TRCN0000155534 GCACCTTATTCCCAAAGGGAT pLKO.1 2710 CDS 100% 2.640 3.696 N CAPRIN2 n/a
3 TRCN0000330682 AGCTCAAACTGGAGGATTATA pLKO_005 458 CDS 100% 15.000 10.500 N CAPRIN2 n/a
4 TRCN0000330685 CAAGCGTATGAGACCTATATT pLKO_005 385 CDS 100% 15.000 10.500 N CAPRIN2 n/a
5 TRCN0000353766 TACTCGTGGTGGGAGATTAAT pLKO_005 2571 CDS 100% 15.000 10.500 N CAPRIN2 n/a
6 TRCN0000330760 TGAATGACAATTAGCACTAAT pLKO_005 3569 3UTR 100% 13.200 9.240 N CAPRIN2 n/a
7 TRCN0000151971 CCGTAGCATCTAAAGAACAAA pLKO.1 2021 CDS 100% 5.625 3.938 N CAPRIN2 n/a
8 TRCN0000150824 GCAGAAAGAACAAGATCCAAA pLKO.1 1542 CDS 100% 4.950 3.465 N CAPRIN2 n/a
9 TRCN0000155105 GCCCAGAAAGAGACAACGAAA pLKO.1 2866 3UTR 100% 4.950 3.465 N CAPRIN2 n/a
10 TRCN0000152566 GCATCTTAATCCAGACCAGTT pLKO.1 501 CDS 100% 4.050 2.835 N CAPRIN2 n/a
11 TRCN0000155311 GCAGGGTATGTTCAAGAGGAA pLKO.1 1480 CDS 100% 2.640 1.848 N CAPRIN2 n/a
12 TRCN0000154973 GCAGTGAATGTGCCACTGTAT pLKO.1 3183 3UTR 100% 0.495 0.297 N CAPRIN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.