Transcript: Human XM_017019931.2

PREDICTED: Homo sapiens calcium voltage-gated channel subunit alpha1 C (CACNA1C), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CACNA1C (775)
Length:
8291
CDS:
1512..8291

Additional Resources:

NCBI RefSeq record:
XM_017019931.2
NBCI Gene record:
CACNA1C (775)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019931.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044673 CGCAGTCAAGTCTAATGTCTT pLKO.1 3431 CDS 100% 4.950 6.930 N CACNA1C n/a
2 TRCN0000044677 CGACATGACCATAGAGGAGAT pLKO.1 8075 CDS 100% 4.050 5.670 N CACNA1C n/a
3 TRCN0000044676 CCAGGGATGTTAGTCTGTATT pLKO.1 4047 CDS 100% 13.200 10.560 N CACNA1C n/a
4 TRCN0000044674 CGGAAGTTCAAGAAGCGCAAA pLKO.1 6759 CDS 100% 4.050 3.240 N CACNA1C n/a
5 TRCN0000431935 TTCAAACCCAAGCACTATTTC pLKO_005 5691 CDS 100% 13.200 9.240 N CACNA1C n/a
6 TRCN0000428691 GCAACTACATCACGTACAAAG pLKO_005 5086 CDS 100% 10.800 7.560 N CACNA1C n/a
7 TRCN0000044675 GCACCAGTACAAAGTGTGGTA pLKO.1 5495 CDS 100% 2.640 1.848 N CACNA1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019931.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.