Transcript: Human XM_017019953.1

PREDICTED: Homo sapiens calcium voltage-gated channel subunit alpha1 C (CACNA1C), transcript variant X29, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CACNA1C (775)
Length:
13531
CDS:
278..6784

Additional Resources:

NCBI RefSeq record:
XM_017019953.1
NBCI Gene record:
CACNA1C (775)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044673 CGCAGTCAAGTCTAATGTCTT pLKO.1 1924 CDS 100% 4.950 6.930 N CACNA1C n/a
2 TRCN0000044677 CGACATGACCATAGAGGAGAT pLKO.1 6568 CDS 100% 4.050 5.670 N CACNA1C n/a
3 TRCN0000044676 CCAGGGATGTTAGTCTGTATT pLKO.1 2540 CDS 100% 13.200 10.560 N CACNA1C n/a
4 TRCN0000044674 CGGAAGTTCAAGAAGCGCAAA pLKO.1 5252 CDS 100% 4.050 3.240 N CACNA1C n/a
5 TRCN0000428691 GCAACTACATCACGTACAAAG pLKO_005 3579 CDS 100% 10.800 7.560 N CACNA1C n/a
6 TRCN0000044675 GCACCAGTACAAAGTGTGGTA pLKO.1 3988 CDS 100% 2.640 1.848 N CACNA1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.