Transcript: Human XM_017019962.2

PREDICTED: Homo sapiens N-acetylglucosamine-1-phosphate transferase subunits alpha and beta (GNPTAB), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GNPTAB (79158)
Length:
5702
CDS:
1494..4037

Additional Resources:

NCBI RefSeq record:
XM_017019962.2
NBCI Gene record:
GNPTAB (79158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055879 GCCGTTAAGTTTGCAGGATTT pLKO.1 3386 CDS 100% 10.800 15.120 N GNPTAB n/a
2 TRCN0000055882 CCTCACATGATTGACCGGATT pLKO.1 3138 CDS 100% 4.050 3.240 N GNPTAB n/a
3 TRCN0000286719 CCTCACATGATTGACCGGATT pLKO_005 3138 CDS 100% 4.050 3.240 N GNPTAB n/a
4 TRCN0000294077 ATTCTTGCTTCTGAGTATAAC pLKO_005 4495 3UTR 100% 13.200 9.240 N GNPTAB n/a
5 TRCN0000055881 GCAGCATTACACAGATAGTTA pLKO.1 2909 CDS 100% 5.625 3.938 N GNPTAB n/a
6 TRCN0000286721 GCAGCATTACACAGATAGTTA pLKO_005 2909 CDS 100% 5.625 3.938 N GNPTAB n/a
7 TRCN0000055878 GCCGAGATCAATACCATGTTT pLKO.1 277 5UTR 100% 5.625 3.938 N GNPTAB n/a
8 TRCN0000286720 GCCGAGATCAATACCATGTTT pLKO_005 277 5UTR 100% 5.625 3.938 N GNPTAB n/a
9 TRCN0000055880 CCCAGAAGTTTATTTACCTAA pLKO.1 1462 5UTR 100% 4.950 3.465 N GNPTAB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.