Transcript: Human XM_017020272.1

PREDICTED: Homo sapiens C2 calcium dependent domain containing 5 (C2CD5), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C2CD5 (9847)
Length:
4508
CDS:
219..3413

Additional Resources:

NCBI RefSeq record:
XM_017020272.1
NBCI Gene record:
C2CD5 (9847)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020272.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148548 CGGTAACAACTGAAAGGGAAA pLKO.1 3907 3UTR 100% 4.050 5.670 N C2CD5 n/a
2 TRCN0000343270 CGGTAACAACTGAAAGGGAAA pLKO_005 3907 3UTR 100% 4.050 5.670 N C2CD5 n/a
3 TRCN0000149885 GCCCGTTGTAAATGAACCTTA pLKO.1 4399 3UTR 100% 4.950 3.960 N C2CD5 n/a
4 TRCN0000146269 CCAACAGATGCAACAGTTATT pLKO.1 1761 CDS 100% 13.200 9.240 N C2CD5 n/a
5 TRCN0000343269 CCAACAGATGCAACAGTTATT pLKO_005 1761 CDS 100% 13.200 9.240 N C2CD5 n/a
6 TRCN0000148286 CCATGATACTTACAGTGCAAA pLKO.1 446 CDS 100% 4.950 3.465 N C2CD5 n/a
7 TRCN0000352816 CCATGATACTTACAGTGCAAA pLKO_005 446 CDS 100% 4.950 3.465 N C2CD5 n/a
8 TRCN0000127940 CCTGACTAATCAAGCTCTCAA pLKO.1 2468 CDS 100% 4.950 3.465 N C2CD5 n/a
9 TRCN0000343214 CCTGACTAATCAAGCTCTCAA pLKO_005 2468 CDS 100% 4.950 3.465 N C2CD5 n/a
10 TRCN0000128219 CTGACTAATCAAGCTCTCAAT pLKO.1 2469 CDS 100% 4.950 3.465 N C2CD5 n/a
11 TRCN0000130031 GCAAAGATGGAACCTTTGTAA pLKO.1 3663 3UTR 100% 0.563 0.394 N C2CD5 n/a
12 TRCN0000130706 GCTGCCTTTGCCATGTAAATT pLKO.1 2560 CDS 100% 15.000 9.000 N C2CD5 n/a
13 TRCN0000343215 GCTGCCTTTGCCATGTAAATT pLKO_005 2560 CDS 100% 15.000 9.000 N C2CD5 n/a
14 TRCN0000252864 GTGACCTGACTGATGCCTTTA pLKO_005 283 CDS 100% 10.800 7.560 N Cyp2d40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020272.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.