Transcript: Human XM_017020305.2

PREDICTED: Homo sapiens FRY microtubule binding protein (FRY), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FRY (10129)
Length:
14805
CDS:
2225..11143

Additional Resources:

NCBI RefSeq record:
XM_017020305.2
NBCI Gene record:
FRY (10129)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020305.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139783 CCGTGCATGAGGATGATCTTT pLKO.1 9894 CDS 100% 5.625 7.875 N FRY n/a
2 TRCN0000140883 GCGATGAACAACAGCGAGATT pLKO.1 2538 CDS 100% 4.950 6.930 N FRY n/a
3 TRCN0000143880 CGATGAACAACAGCGAGATTA pLKO.1 2539 CDS 100% 13.200 10.560 N FRY n/a
4 TRCN0000145440 GTTACATTTGACCGAGCATAT pLKO.1 11382 3UTR 100% 10.800 8.640 N FRY n/a
5 TRCN0000122800 GCGGAGACAACTATGTTACTT pLKO.1 4794 CDS 100% 5.625 4.500 N FRY n/a
6 TRCN0000140330 CGCTGGAACTTTCTTCTCGAA pLKO.1 3117 CDS 100% 2.640 2.112 N FRY n/a
7 TRCN0000144616 GCTGAAGGATGAGTGTTAATT pLKO.1 11910 3UTR 100% 15.000 10.500 N FRY n/a
8 TRCN0000139909 GCTGATAGCTTGCAGCAGAAA pLKO.1 3590 CDS 100% 4.950 3.465 N FRY n/a
9 TRCN0000142765 CCCAATCAGTTCTGTAAGGAT pLKO.1 8549 CDS 100% 3.000 2.100 N FRY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020305.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.