Transcript: Human XM_017020306.1

PREDICTED: Homo sapiens FRY microtubule binding protein (FRY), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FRY (10129)
Length:
9946
CDS:
66..6284

Additional Resources:

NCBI RefSeq record:
XM_017020306.1
NBCI Gene record:
FRY (10129)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020306.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139783 CCGTGCATGAGGATGATCTTT pLKO.1 5035 CDS 100% 5.625 7.875 N FRY n/a
2 TRCN0000145440 GTTACATTTGACCGAGCATAT pLKO.1 6523 3UTR 100% 10.800 8.640 N FRY n/a
3 TRCN0000144616 GCTGAAGGATGAGTGTTAATT pLKO.1 7051 3UTR 100% 15.000 10.500 N FRY n/a
4 TRCN0000142765 CCCAATCAGTTCTGTAAGGAT pLKO.1 3690 CDS 100% 3.000 2.100 N FRY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020306.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.