Transcript: Human XM_017020423.1

PREDICTED: Homo sapiens leucine rich repeat containing 63 (LRRC63), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC63 (220416)
Length:
2453
CDS:
821..2434

Additional Resources:

NCBI RefSeq record:
XM_017020423.1
NBCI Gene record:
LRRC63 (220416)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020423.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144027 CAGCAACACGATATGAAACAA pLKO.1 1572 CDS 100% 5.625 7.875 N LRRC63 n/a
2 TRCN0000145429 GAATCAGAGATACACGTTGTA pLKO.1 1526 CDS 100% 4.950 6.930 N LRRC63 n/a
3 TRCN0000145324 GTAATTCAGCTTCTACTCGAA pLKO.1 1008 CDS 100% 2.640 3.696 N LRRC63 n/a
4 TRCN0000144474 CTTTGGCTTTCCAGTTGATAT pLKO.1 1695 CDS 100% 13.200 9.240 N LRRC63 n/a
5 TRCN0000121975 GCAACACGATATGAAACAATA pLKO.1 1574 CDS 100% 13.200 9.240 N LRRC63 n/a
6 TRCN0000141303 CACAGGCAGTCTGTGATAGAA pLKO.1 1415 CDS 100% 0.563 0.394 N LRRC63 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 25 5UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 25 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020423.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.