Transcript: Human XM_017020625.2

PREDICTED: Homo sapiens ATPase phospholipid transporting 8A2 (ATP8A2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP8A2 (51761)
Length:
2496
CDS:
203..2458

Additional Resources:

NCBI RefSeq record:
XM_017020625.2
NBCI Gene record:
ATP8A2 (51761)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020625.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043499 CGATTCTTGTATGAGCAGATT pLKO.1 458 CDS 100% 4.950 6.930 N ATP8A2 n/a
2 TRCN0000043502 GCGCCTCTCAAGAGATCAAAT pLKO.1 1106 CDS 100% 13.200 10.560 N ATP8A2 n/a
3 TRCN0000043500 CGGAGTAACCTATGGTCACTT pLKO.1 1540 CDS 100% 4.950 3.465 N ATP8A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020625.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.