Transcript: Human XM_017020684.1

PREDICTED: Homo sapiens G protein-coupled receptor kinase 1 (GRK1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRK1 (6011)
Length:
3768
CDS:
2481..3467

Additional Resources:

NCBI RefSeq record:
XM_017020684.1
NBCI Gene record:
GRK1 (6011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020684.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195622 CCCTCTTCAAGGACCTTAACT pLKO.1 3133 CDS 100% 5.625 7.875 N GRK1 n/a
2 TRCN0000001486 CGTGAAGTACCCTGATAAGTT pLKO.1 3011 CDS 100% 5.625 3.938 N GRK1 n/a
3 TRCN0000001488 CTACAACGTGAATGAGGAGAA pLKO.1 2612 CDS 100% 4.050 2.835 N GRK1 n/a
4 TRCN0000199423 CGGGCATCTTTGGCGAGCTGA pLKO.1 3349 CDS 100% 0.000 0.000 N GRK1 n/a
5 TRCN0000010624 CTCTGGCCTATGCGTTTGAAA pLKO.1 2530 CDS 100% 5.625 3.375 N GRK1 n/a
6 TRCN0000199366 CGTGGTTCCCTCCACCCAGGT pLKO.1 3568 3UTR 100% 0.000 0.000 N GRK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020684.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.