Transcript: Human XM_017020848.1

PREDICTED: Homo sapiens doublecortin like kinase 1 (DCLK1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DCLK1 (9201)
Length:
6148
CDS:
237..1328

Additional Resources:

NCBI RefSeq record:
XM_017020848.1
NBCI Gene record:
DCLK1 (9201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146493 AAAAGATCGGAACCGGTCTG pXPR_003 GGG 235 22% 2 -0.2167 DCLK1 DCLK1 76748
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002148 TCTGTCGGATAACGTGAATTT pLKO.1 518 CDS 100% 13.200 18.480 N DCLK1 n/a
2 TRCN0000356153 ACCCGAACTCTGTCGGATAAC pLKO_005 510 CDS 100% 10.800 15.120 N DCLK1 n/a
3 TRCN0000195597 CGAAACGGAGATCGATACTTC pLKO.1 423 CDS 100% 4.950 6.930 N DCLK1 n/a
4 TRCN0000196643 GTGAGAACAATCTACACCATT pLKO.1 549 CDS 100% 4.950 3.465 N DCLK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.