Transcript: Human XM_017020971.1

PREDICTED: Homo sapiens Jun dimerization protein 2 (JDP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
JDP2 (122953)
Length:
4569
CDS:
2967..3587

Additional Resources:

NCBI RefSeq record:
XM_017020971.1
NBCI Gene record:
JDP2 (122953)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019001 ACTCATGAACGCAGAGCTGAA pLKO.1 3419 CDS 100% 4.050 5.670 N JDP2 n/a
2 TRCN0000019000 CGGGAGAAGAACAAAGTCGCA pLKO.1 3330 CDS 100% 0.660 0.924 N JDP2 n/a
3 TRCN0000376757 TGCACTTCCTGGAGGTGAAAC pLKO_005 3244 CDS 100% 10.800 7.560 N Jdp2 n/a
4 TRCN0000274839 CCGATGCCGGAACAAGAAGAA pLKO_005 3356 CDS 100% 4.950 3.465 N JDP2 n/a
5 TRCN0000274901 AGCTCATCCTGATGCTGAACC pLKO_005 3475 CDS 100% 4.050 2.835 N JDP2 n/a
6 TRCN0000018999 CCTGGAGGTGAAACTGGGCAA pLKO.1 3251 CDS 100% 0.720 0.504 N JDP2 n/a
7 TRCN0000019002 CGAGTCAGAAGGCAACCCACT pLKO.1 3542 CDS 100% 0.720 0.504 N JDP2 n/a
8 TRCN0000285260 CGAGTCAGAAGGCAACCCACT pLKO_005 3542 CDS 100% 0.720 0.504 N JDP2 n/a
9 TRCN0000019003 GACTGTGGAGGAGCTGAAATA pLKO.1 3185 CDS 100% 13.200 7.920 N JDP2 n/a
10 TRCN0000274840 GACTGTGGAGGAGCTGAAATA pLKO_005 3185 CDS 100% 13.200 7.920 N JDP2 n/a
11 TRCN0000274841 GAGGAAGAGGAGCGAAGGAAA pLKO_005 3303 CDS 100% 4.950 2.970 N JDP2 n/a
12 TRCN0000081973 GCCCTTCCAAAGCACATACTT pLKO.1 4199 3UTR 100% 5.625 3.938 N Jdp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.