Transcript: Human XM_017021565.1

PREDICTED: Homo sapiens AT-rich interaction domain 4A (ARID4A), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARID4A (5926)
Length:
5934
CDS:
1383..4190

Additional Resources:

NCBI RefSeq record:
XM_017021565.1
NBCI Gene record:
ARID4A (5926)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014593 CCTGCCATATTTGTCATAATT pLKO.1 4397 3UTR 100% 15.000 21.000 N ARID4A n/a
2 TRCN0000358456 GTACTGCCGTTCGGCAAATAT pLKO_005 1610 CDS 100% 15.000 21.000 N ARID4A n/a
3 TRCN0000358457 ACGATTGAAGTTGATAGTATT pLKO_005 3492 CDS 100% 13.200 18.480 N ARID4A n/a
4 TRCN0000014597 CCTCTCATCAAACATGCCGTA pLKO.1 2438 CDS 100% 2.160 1.728 N ARID4A n/a
5 TRCN0000358372 TGATGGAAATAGTGGATTAAT pLKO_005 3644 CDS 100% 15.000 10.500 N ARID4A n/a
6 TRCN0000014596 CGGCAAATGGATTTGAAACTA pLKO.1 3550 CDS 100% 5.625 3.938 N ARID4A n/a
7 TRCN0000014594 GCTCTCAAATTAGATCAAGAA pLKO.1 1707 CDS 100% 4.950 3.465 N ARID4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.