Transcript: Human XM_017021652.1

PREDICTED: Homo sapiens Ras and Rab interactor 3 (RIN3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RIN3 (79890)
Length:
3728
CDS:
161..2986

Additional Resources:

NCBI RefSeq record:
XM_017021652.1
NBCI Gene record:
RIN3 (79890)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077867 GCACATCAAGAGCTACGACAA pLKO.1 2533 CDS 100% 4.050 5.670 N RIN3 n/a
2 TRCN0000333038 GCACATCAAGAGCTACGACAA pLKO_005 2533 CDS 100% 4.050 5.670 N RIN3 n/a
3 TRCN0000077863 CGAGACGGCATGTTCTTCATT pLKO.1 3194 3UTR 100% 5.625 3.938 N RIN3 n/a
4 TRCN0000333039 CGAGACGGCATGTTCTTCATT pLKO_005 3194 3UTR 100% 5.625 3.938 N RIN3 n/a
5 TRCN0000077866 GAGGACATCTTCAGATTGATT pLKO.1 560 CDS 100% 5.625 3.938 N RIN3 n/a
6 TRCN0000333104 GAGGACATCTTCAGATTGATT pLKO_005 560 CDS 100% 5.625 3.938 N RIN3 n/a
7 TRCN0000077652 CCTGTGGTTTGTGAATCCTAT pLKO.1 853 CDS 100% 4.950 3.465 N Rin3 n/a
8 TRCN0000077864 GCTCAAGACCTGCAAACTCAT pLKO.1 2446 CDS 100% 4.950 3.465 N RIN3 n/a
9 TRCN0000333037 GCTCAAGACCTGCAAACTCAT pLKO_005 2446 CDS 100% 4.950 3.465 N RIN3 n/a
10 TRCN0000077865 GCCTGTGGTTTGTGAATCCTA pLKO.1 852 CDS 100% 3.000 1.800 N RIN3 n/a
11 TRCN0000363733 GCCTGTGGTTTGTGAATCCTA pLKO_005 852 CDS 100% 3.000 1.800 N RIN3 n/a
12 TRCN0000156756 GAGGAAGAGGAAGAGGAAGAT pLKO.1 230 CDS 100% 4.950 2.475 Y NPM2 n/a
13 TRCN0000152515 GAAGAGGAAGAGGAAGATGAT pLKO.1 233 CDS 100% 4.950 2.475 Y NPM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.