Transcript: Human XM_017022013.1

PREDICTED: Homo sapiens FANCD2 and FANCI associated nuclease 1 (FAN1), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAN1 (22909)
Length:
4674
CDS:
1746..3128

Additional Resources:

NCBI RefSeq record:
XM_017022013.1
NBCI Gene record:
FAN1 (22909)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022013.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412880 GCTACTGGTCAGAAGTTATAT pLKO_005 1510 5UTR 100% 15.000 21.000 N FAN1 n/a
2 TRCN0000437751 AGAGACACGTGGCAGAATAAC pLKO_005 3420 3UTR 100% 13.200 18.480 N FAN1 n/a
3 TRCN0000430194 CAGCGGAAGTAGCACAGTTTC pLKO_005 3379 3UTR 100% 10.800 15.120 N FAN1 n/a
4 TRCN0000134018 CCAATGATCGTCTTTCACATA pLKO.1 3010 CDS 100% 4.950 6.930 N FAN1 n/a
5 TRCN0000242206 AGGCTCTTTCAACGTAAATTA pLKO_005 1534 5UTR 100% 15.000 10.500 N Fan1 n/a
6 TRCN0000435987 ATCGTAGTGTGAAAGTCATTT pLKO_005 707 5UTR 100% 13.200 9.240 N FAN1 n/a
7 TRCN0000434039 CACTGATGATTCCATTCTTTA pLKO_005 3578 3UTR 100% 13.200 9.240 N FAN1 n/a
8 TRCN0000434112 TGTTAAGAGCCTGATTGATAA pLKO_005 840 5UTR 100% 13.200 9.240 N FAN1 n/a
9 TRCN0000436246 AGAGCCAAAGCCTTAGCTAAA pLKO_005 3109 CDS 100% 10.800 7.560 N FAN1 n/a
10 TRCN0000133972 CCAGATTTCACTCTTAGGAAT pLKO.1 1075 5UTR 100% 4.950 3.465 N FAN1 n/a
11 TRCN0000136648 GCTGTTACTATCAGCCTGAAT pLKO.1 3838 3UTR 100% 4.950 3.465 N FAN1 n/a
12 TRCN0000138083 GCTCTTTGATGAGCAGGAGAA pLKO.1 1458 5UTR 100% 4.050 2.835 N FAN1 n/a
13 TRCN0000133973 CCTTAGAAGATGTAACACCTA pLKO.1 554 5UTR 100% 2.640 1.848 N FAN1 n/a
14 TRCN0000137872 CGTCACTTTAAGCTGGTGGAA pLKO.1 2979 CDS 100% 2.640 1.848 N FAN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022013.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.