Transcript: Human XM_017022134.2

PREDICTED: Homo sapiens formin 1 (FMN1), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FMN1 (342184)
Length:
11931
CDS:
739..3165

Additional Resources:

NCBI RefSeq record:
XM_017022134.2
NBCI Gene record:
FMN1 (342184)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022134.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242233 GGAATCTTGATATCTAGTTTA pLKO_005 2083 CDS 100% 13.200 18.480 N FMN1 n/a
2 TRCN0000242235 CCCAGTGAATTTGAGTATTTA pLKO_005 1948 CDS 100% 15.000 10.500 N FMN1 n/a
3 TRCN0000242232 ATATTGGACTAGGATACAAAT pLKO_005 1860 CDS 100% 13.200 9.240 N FMN1 n/a
4 TRCN0000242236 TCACACCCAGCTACGTGTTTA pLKO_005 2942 CDS 100% 13.200 9.240 N FMN1 n/a
5 TRCN0000242234 TCTGGTGGACTACGTTGTTAA pLKO_005 2574 CDS 100% 13.200 9.240 N FMN1 n/a
6 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 6172 3UTR 100% 4.050 2.025 Y LOC441087 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022134.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.