Transcript: Human XM_017022260.1

PREDICTED: Homo sapiens OCA2 melanosomal transmembrane protein (OCA2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OCA2 (4948)
Length:
3049
CDS:
90..2534

Additional Resources:

NCBI RefSeq record:
XM_017022260.1
NBCI Gene record:
OCA2 (4948)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428712 ATCACAACCCATTAGTCATAA pLKO_005 2578 3UTR 100% 13.200 18.480 N OCA2 n/a
2 TRCN0000425497 TCACAACTGGACGGTGTATTT pLKO_005 926 CDS 100% 13.200 18.480 N OCA2 n/a
3 TRCN0000059562 CGCGCTGATCATATTTGAGAT pLKO.1 1139 CDS 100% 4.950 6.930 N OCA2 n/a
4 TRCN0000059561 CCTGATTGACAACATCCCGTT pLKO.1 2186 CDS 100% 2.160 1.728 N OCA2 n/a
5 TRCN0000438220 ACGGGATTCTGCTCGCCAAAT pLKO_005 1831 CDS 100% 10.800 7.560 N OCA2 n/a
6 TRCN0000059560 CCAGAGTTCATCACTGCTGAA pLKO.1 465 CDS 100% 4.050 2.835 N OCA2 n/a
7 TRCN0000059559 GCACACATGTTCATTGGGATT pLKO.1 1503 CDS 100% 4.050 2.835 N OCA2 n/a
8 TRCN0000059558 GCATTCATCTTGATCTTGGAT pLKO.1 1909 CDS 100% 3.000 2.100 N OCA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.