Transcript: Human XM_017022395.1

PREDICTED: Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UACA (55075)
Length:
4338
CDS:
16..4215

Additional Resources:

NCBI RefSeq record:
XM_017022395.1
NBCI Gene record:
UACA (55075)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022395.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159713 GAAGAGTTTAAGAGGGATGAA pLKO.1 1687 CDS 100% 4.950 6.930 N UACA n/a
2 TRCN0000159821 GCAGAGCATTTGCAGATTAAA pLKO.1 3463 CDS 100% 15.000 10.500 N UACA n/a
3 TRCN0000159915 CGAGCTAAACAAACAGTTAAA pLKO.1 3162 CDS 100% 13.200 9.240 N UACA n/a
4 TRCN0000158831 GCAAGAGAATGACAAGTTAAA pLKO.1 3045 CDS 100% 13.200 9.240 N UACA n/a
5 TRCN0000159714 GCAGGATAGTAATGCTGAAAT pLKO.1 2790 CDS 100% 13.200 9.240 N UACA n/a
6 TRCN0000158521 CCCTTAAAGAACACTTAACAA pLKO.1 1529 CDS 100% 5.625 3.938 N UACA n/a
7 TRCN0000159745 GCCAATCTGAATAGAAAGTAT pLKO.1 3706 CDS 100% 5.625 3.938 N UACA n/a
8 TRCN0000159715 GCAAGAAATTAAGGATCAGAA pLKO.1 3813 CDS 100% 4.950 3.465 N UACA n/a
9 TRCN0000159040 GAAGTAAATGTGAAGTCACAT pLKO.1 811 CDS 100% 0.495 0.347 N UACA n/a
10 TRCN0000159620 GCAGCAGATTGGAATAAATAT pLKO.1 46 CDS 100% 15.000 9.000 N UACA n/a
11 TRCN0000160533 CCTTATACATGGAGTTGATAT pLKO.1 225 CDS 100% 13.200 7.920 N UACA n/a
12 TRCN0000158965 GAACAGGTTAAGAGCAGATTA pLKO.1 2026 CDS 100% 13.200 7.920 N UACA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022395.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.