Transcript: Human XM_017022410.2

PREDICTED: Homo sapiens myosin VC (MYO5C), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYO5C (55930)
Length:
6825
CDS:
1405..5241

Additional Resources:

NCBI RefSeq record:
XM_017022410.2
NBCI Gene record:
MYO5C (55930)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022410.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162244 CAGTTGCCAATATACGGAGAT pLKO.1 471 5UTR 100% 4.050 5.670 N MYO5C n/a
2 TRCN0000160881 GCAGGACAAGTGGCTTATTTA pLKO.1 2236 CDS 100% 15.000 12.000 N MYO5C n/a
3 TRCN0000278547 GCAGGACAAGTGGCTTATTTA pLKO_005 2236 CDS 100% 15.000 12.000 N MYO5C n/a
4 TRCN0000159318 GCCAACATATTCACCATAATT pLKO.1 6253 3UTR 100% 15.000 10.500 N MYO5C n/a
5 TRCN0000278494 GCCAACATATTCACCATAATT pLKO_005 6253 3UTR 100% 15.000 10.500 N MYO5C n/a
6 TRCN0000158936 GCTATGACATTGAAGATGTAA pLKO.1 3350 CDS 100% 5.625 3.938 N MYO5C n/a
7 TRCN0000278495 GCTATGACATTGAAGATGTAA pLKO_005 3350 CDS 100% 5.625 3.938 N MYO5C n/a
8 TRCN0000159847 GCTACTTAGAAGAATGGCTTA pLKO.1 4844 CDS 100% 4.050 2.835 N MYO5C n/a
9 TRCN0000297474 GCTACTTAGAAGAATGGCTTA pLKO_005 4844 CDS 100% 4.050 2.835 N MYO5C n/a
10 TRCN0000162536 CCTGTATCAGTTGATTCGCAT pLKO.1 2487 CDS 100% 2.640 1.848 N MYO5C n/a
11 TRCN0000278493 CCTGTATCAGTTGATTCGCAT pLKO_005 2487 CDS 100% 2.640 1.848 N MYO5C n/a
12 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 6064 3UTR 100% 10.800 5.400 Y MRPS16 n/a
13 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 6064 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022410.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.