Transcript: Human XM_017022923.1

PREDICTED: Homo sapiens acyl-CoA synthetase medium chain family member 2A (ACSM2A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACSM2A (123876)
Length:
2929
CDS:
205..1938

Additional Resources:

NCBI RefSeq record:
XM_017022923.1
NBCI Gene record:
ACSM2A (123876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178946 CTTATGGAACCTTGGGCATTA pLKO.1 1021 CDS 100% 10.800 15.120 N ACSM2A n/a
2 TRCN0000241526 CTTATGGAACCTTGGGCATTA pLKO_005 1021 CDS 100% 10.800 15.120 N ACSM2A n/a
3 TRCN0000241524 CACTAACCCAGATGCATTATA pLKO_005 2750 3UTR 100% 15.000 10.500 N ACSM2A n/a
4 TRCN0000241525 GTGCGCAGTGAGACATCTAAG pLKO_005 1928 CDS 100% 10.800 7.560 N ACSM2A n/a
5 TRCN0000241522 TGAGACATCTAAGAGACATTC pLKO_005 1936 CDS 100% 10.800 7.560 N ACSM2A n/a
6 TRCN0000241523 GAACATCTTGTGCTCACTTAT pLKO_005 1005 CDS 100% 13.200 7.920 N ACSM2A n/a
7 TRCN0000423707 AGTTTGACCCACTGGTTATTC pLKO_005 1073 CDS 100% 13.200 6.600 Y ACSM2B n/a
8 TRCN0000048562 GCAGGATCTTTCCAGTTACAA pLKO.1 1164 CDS 100% 5.625 2.813 Y ACSM2B n/a
9 TRCN0000147149 CCAGTTATCCAATCAAGAGTA pLKO.1 1106 CDS 100% 4.950 2.475 Y ACSM2A n/a
10 TRCN0000048558 CGGGATTAACTTGCATGGTTT pLKO.1 1301 CDS 100% 4.950 2.475 Y ACSM2B n/a
11 TRCN0000147477 GTACCCAAGAAAGATAGAGTT pLKO.1 1821 CDS 100% 0.000 0.000 Y ACSM2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.