Transcript: Human XM_017023097.2

PREDICTED: Homo sapiens RPGRIP1 like (RPGRIP1L), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RPGRIP1L (23322)
Length:
3015
CDS:
44..2407

Additional Resources:

NCBI RefSeq record:
XM_017023097.2
NBCI Gene record:
RPGRIP1L (23322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023097.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267655 AGGGCTGCACGTATCCATAAA pLKO_005 1727 CDS 100% 13.200 18.480 N RPGRIP1L n/a
2 TRCN0000256929 TGGAATACTGGTTCCGATTAA pLKO_005 2241 CDS 100% 13.200 18.480 N RPGRIP1L n/a
3 TRCN0000062007 GCCACCAAGTTAATACGGCTA pLKO.1 278 CDS 100% 2.160 3.024 N RPGRIP1L n/a
4 TRCN0000062005 CCTGTGAAAGATACAGGTCTA pLKO.1 80 CDS 100% 0.405 0.324 N RPGRIP1L n/a
5 TRCN0000256935 AGGCCTTCATCCCGAATATAA pLKO_005 2002 CDS 100% 15.000 10.500 N RPGRIP1L n/a
6 TRCN0000256931 GTGAAGCTCTCCTACTTATAA pLKO_005 1434 CDS 100% 15.000 10.500 N RPGRIP1L n/a
7 TRCN0000256930 GATCAAGCAATTCGACTTTAT pLKO_005 2273 CDS 100% 13.200 9.240 N RPGRIP1L n/a
8 TRCN0000256934 ACTTCAACAACACGGACAATG pLKO_005 131 CDS 100% 10.800 7.560 N RPGRIP1L n/a
9 TRCN0000106079 CGGCTAGTTAATGACAAGAAA pLKO.1 293 CDS 100% 5.625 3.938 N Rpgrip1l n/a
10 TRCN0000062004 GCAGCAAGATTATGAACTCAA pLKO.1 1675 CDS 100% 4.950 3.465 N RPGRIP1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023097.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.