Transcript: Human XM_017023099.1

PREDICTED: Homo sapiens RPGRIP1 like (RPGRIP1L), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RPGRIP1L (23322)
Length:
4491
CDS:
129..2321

Additional Resources:

NCBI RefSeq record:
XM_017023099.1
NBCI Gene record:
RPGRIP1L (23322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256927 ACCTAATTTGCCGTGATATAT pLKO_005 3516 3UTR 100% 15.000 21.000 N RPGRIP1L n/a
2 TRCN0000256933 AGTGGGTCTACTATAACTATA pLKO_005 1963 CDS 100% 13.200 18.480 N RPGRIP1L n/a
3 TRCN0000256929 TGGAATACTGGTTCCGATTAA pLKO_005 559 CDS 100% 13.200 18.480 N RPGRIP1L n/a
4 TRCN0000256935 AGGCCTTCATCCCGAATATAA pLKO_005 320 CDS 100% 15.000 10.500 N RPGRIP1L n/a
5 TRCN0000256930 GATCAAGCAATTCGACTTTAT pLKO_005 591 CDS 100% 13.200 9.240 N RPGRIP1L n/a
6 TRCN0000062003 GCCTATGATTAGCTTCATTAA pLKO.1 2744 3UTR 100% 13.200 9.240 N RPGRIP1L n/a
7 TRCN0000256932 TAGCGTGAGAAAGTCTATTTG pLKO_005 2587 3UTR 100% 13.200 9.240 N RPGRIP1L n/a
8 TRCN0000256928 TCCACAGTTTGATGATCATAT pLKO_005 878 CDS 100% 13.200 9.240 N RPGRIP1L n/a
9 TRCN0000062006 GCCTAATAGAAGCCTTCGCTT pLKO.1 2063 CDS 100% 2.640 1.848 N RPGRIP1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.