Transcript: Human XM_017023156.2

PREDICTED: Homo sapiens NODAL modulator 2 (NOMO2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NOMO2 (283820)
Length:
2074
CDS:
104..2059

Additional Resources:

NCBI RefSeq record:
XM_017023156.2
NBCI Gene record:
NOMO2 (283820)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023156.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142132 GCTCATCGAGATAAAGCTGTA pLKO.1 259 CDS 100% 4.050 2.430 N NOMO2 n/a
2 TRCN0000142616 GATGGCTCGTTCTCTTTCTAT pLKO.1 929 CDS 100% 5.625 2.813 Y NOMO2 n/a
3 TRCN0000140189 GTGGAGCATGACAGCTTGAAA pLKO.1 1040 CDS 100% 5.625 2.813 Y NOMO2 n/a
4 TRCN0000141010 CCTCATAGTTGCTGGCTACAA pLKO.1 736 CDS 100% 4.950 2.475 Y NOMO1 n/a
5 TRCN0000142100 GCAAAGATCCAGTCCACAGTT pLKO.1 575 CDS 100% 4.950 2.475 Y NOMO1 n/a
6 TRCN0000140619 GTGCGTGTAACCAACTCCAAT pLKO.1 698 CDS 100% 4.950 2.475 Y NOMO2 n/a
7 TRCN0000141855 GACTTACAAAGTGCAGGTGAT pLKO.1 1483 CDS 100% 4.050 2.025 Y NOMO2 n/a
8 TRCN0000142272 GCCTGGAGATTATGAAATCCT pLKO.1 634 CDS 100% 3.000 1.500 Y NOMO2 n/a
9 TRCN0000143133 CTACTTTGAAACGGTCACCAT pLKO.1 1255 CDS 100% 2.640 1.320 Y NOMO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023156.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.