Transcript: Human XM_017023188.2

PREDICTED: Homo sapiens general transcription factor IIIC subunit 1 (GTF3C1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GTF3C1 (2975)
Length:
6910
CDS:
33..6173

Additional Resources:

NCBI RefSeq record:
XM_017023188.2
NBCI Gene record:
GTF3C1 (2975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235069 CAGGCCTATCTCAACTATAAA pLKO_005 3825 CDS 100% 15.000 21.000 N GTF3C1 n/a
2 TRCN0000235068 CAGTGAACGGAGAACGATAAA pLKO_005 2510 CDS 100% 13.200 18.480 N GTF3C1 n/a
3 TRCN0000235067 CTTCGCTTAATCGAGAGTTTA pLKO_005 1914 CDS 100% 13.200 18.480 N GTF3C1 n/a
4 TRCN0000235066 TAAGCGTCTGTACCAGTATAT pLKO_005 902 CDS 100% 13.200 9.240 N GTF3C1 n/a
5 TRCN0000235070 AGTCACAGACTGACACGTTTC pLKO_005 6308 3UTR 100% 6.000 4.200 N GTF3C1 n/a
6 TRCN0000017321 CCTGATCGTTTCTCTTTCAAA pLKO.1 4458 CDS 100% 5.625 3.938 N GTF3C1 n/a
7 TRCN0000017320 CGACTTCTTCAAAGATTCAAA pLKO.1 1245 CDS 100% 5.625 3.938 N GTF3C1 n/a
8 TRCN0000017322 CCGCTACTTTAAGGAGAGGAA pLKO.1 374 CDS 100% 2.640 1.848 N GTF3C1 n/a
9 TRCN0000017318 CACCTCACATTCCAGACTCTA pLKO.1 6476 3UTR 100% 4.950 2.970 N GTF3C1 n/a
10 TRCN0000017319 CCTTCCTGTATGCAAGGGTAT pLKO.1 5828 CDS 100% 4.050 2.430 N GTF3C1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.