Transcript: Human XM_017023202.1

PREDICTED: Homo sapiens polycystin 1 like 3, transient receptor potential channel interacting (PKD1L3), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PKD1L3 (342372)
Length:
4176
CDS:
424..4098

Additional Resources:

NCBI RefSeq record:
XM_017023202.1
NBCI Gene record:
PKD1L3 (342372)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023202.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155116 GCATCTGGTCAGGTCATAGAT pLKO.1 1246 CDS 100% 5.625 7.875 N PKD1L3 n/a
2 TRCN0000152232 CCTAGCTCATATTTGGAACAA pLKO.1 594 CDS 100% 4.950 3.960 N PKD1L3 n/a
3 TRCN0000150367 CGCTCAATTTCACTACCTTAT pLKO.1 2643 CDS 100% 10.800 7.560 N PKD1L3 n/a
4 TRCN0000153676 CCAGGTAATTGTCTGTGACAT pLKO.1 2898 CDS 100% 4.950 3.465 N PKD1L3 n/a
5 TRCN0000154788 GCCTGTCCAAATGGTTGACTT pLKO.1 3866 CDS 100% 4.950 3.465 N PKD1L3 n/a
6 TRCN0000155773 CAGAGAGGATTCCTAGCTCAT pLKO.1 583 CDS 100% 4.050 2.835 N PKD1L3 n/a
7 TRCN0000155136 CCCAGGATTATCTGTGGCTTT pLKO.1 3071 CDS 100% 4.050 2.835 N PKD1L3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023202.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.