Transcript: Human XM_017023214.1

PREDICTED: Homo sapiens ATP binding cassette subfamily C member 6 (ABCC6), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCC6 (368)
Length:
4004
CDS:
183..3683

Additional Resources:

NCBI RefSeq record:
XM_017023214.1
NBCI Gene record:
ABCC6 (368)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059715 GTGGCCGAGAATGCTATGAAT pLKO.1 1851 CDS 100% 5.625 4.500 N ABCC6 n/a
2 TRCN0000059716 CCACAGAATAAACCTCACGGT pLKO.1 2120 CDS 100% 0.660 0.528 N ABCC6 n/a
3 TRCN0000284369 CCCAGGCTGATTGGATCATAG pLKO_005 2635 CDS 100% 10.800 7.560 N ABCC6 n/a
4 TRCN0000271321 CCCATTGGTCACCTGCTAAAC pLKO_005 3300 CDS 100% 10.800 7.560 N ABCC6 n/a
5 TRCN0000271257 TCGTGGTCTGCTTCGTCTATC pLKO_005 1492 CDS 100% 10.800 7.560 N ABCC6 n/a
6 TRCN0000059714 CGATCTCCCATCAGCTTCTTT pLKO.1 3270 CDS 100% 5.625 3.938 N ABCC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.