Transcript: Human XM_017023427.1

PREDICTED: Homo sapiens dynein axonemal heavy chain 3 (DNAH3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAH3 (55567)
Length:
12729
CDS:
696..12686

Additional Resources:

NCBI RefSeq record:
XM_017023427.1
NBCI Gene record:
DNAH3 (55567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023427.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144154 CTGGAAAGATAGTCGATGATA pLKO.1 7384 CDS 100% 5.625 7.875 N DNAH3 n/a
2 TRCN0000143963 CGCATACAAGACAATTTGGAT pLKO.1 3558 CDS 100% 3.000 4.200 N DNAH3 n/a
3 TRCN0000140295 GCCAAGTTCTTAGCGCAAGAT pLKO.1 5250 CDS 100% 4.950 3.960 N DNAH3 n/a
4 TRCN0000139907 GCCCAAGGAATCAAGAACGAA pLKO.1 8580 CDS 100% 3.000 2.400 N DNAH3 n/a
5 TRCN0000431305 TAGAGTTGGTGGCTAACAAAT pLKO_005 8134 CDS 100% 13.200 9.240 N DNAH3 n/a
6 TRCN0000436096 TGACGTTCAGCTTCGTGAAAT pLKO_005 3388 CDS 100% 13.200 9.240 N DNAH3 n/a
7 TRCN0000141402 CCCAAGGAATCAAGAACGAAT pLKO.1 8581 CDS 100% 4.950 3.465 N DNAH3 n/a
8 TRCN0000141800 GCCTCTCAAATATGCTCGAAT pLKO.1 3259 CDS 100% 4.950 3.465 N DNAH3 n/a
9 TRCN0000140040 GCTCAAGTATCCAGAGGAGAA pLKO.1 5186 CDS 100% 4.050 2.835 N DNAH3 n/a
10 TRCN0000140039 GCACCCTTCAAAGAACAGCAT pLKO.1 912 CDS 100% 2.640 1.848 N DNAH3 n/a
11 TRCN0000140365 GCAGACAAAGTCAGTGAGGTT pLKO.1 2418 CDS 100% 2.640 1.848 N DNAH3 n/a
12 TRCN0000139467 CGGGAGTTCATTGCTGAACAT pLKO.1 10800 CDS 100% 0.495 0.347 N DNAH3 n/a
13 TRCN0000144109 CCAGATGTTTCTCAATGACTA pLKO.1 11465 CDS 100% 4.950 2.970 N DNAH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023427.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.