Transcript: Human XM_017023496.2

PREDICTED: Homo sapiens ubiquitin specific peptidase 31 (USP31), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP31 (57478)
Length:
10606
CDS:
32..3970

Additional Resources:

NCBI RefSeq record:
XM_017023496.2
NBCI Gene record:
USP31 (57478)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273355 CCTTTGAGACTCCCGAAATAT pLKO_005 1215 CDS 100% 15.000 21.000 N USP31 n/a
2 TRCN0000273356 TGTTCAAAGCGTCGCCTTATT pLKO_005 4139 3UTR 100% 13.200 18.480 N USP31 n/a
3 TRCN0000004550 CTGTAGTGTATCAAGGCAAAT pLKO.1 999 CDS 100% 10.800 8.640 N USP31 n/a
4 TRCN0000284965 ATTTGGCTTGGATTATCATAG pLKO_005 1300 CDS 100% 10.800 7.560 N USP31 n/a
5 TRCN0000273291 GCCGCGACTTCAAGACTATTG pLKO_005 651 CDS 100% 10.800 7.560 N USP31 n/a
6 TRCN0000004548 GACAGCATACATCCTCTTCTA pLKO.1 2176 CDS 100% 4.950 3.465 N USP31 n/a
7 TRCN0000284966 GACAGCATACATCCTCTTCTA pLKO_005 2176 CDS 100% 4.950 3.465 N USP31 n/a
8 TRCN0000004552 GCTCTGTTAAGTCTGTCTGTA pLKO.1 3681 CDS 100% 4.950 3.465 N USP31 n/a
9 TRCN0000004549 GCTCCAATTCTCCATCCCGAT pLKO.1 2538 CDS 100% 2.160 1.512 N USP31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.