Transcript: Human XM_017023539.2

PREDICTED: Homo sapiens xylosyltransferase 1 (XYLT1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XYLT1 (64131)
Length:
2792
CDS:
80..2698

Additional Resources:

NCBI RefSeq record:
XM_017023539.2
NBCI Gene record:
XYLT1 (64131)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023539.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034880 CGGGACAATGCAAGGTTCATT pLKO.1 1436 CDS 100% 5.625 7.875 N XYLT1 n/a
2 TRCN0000034881 CGTGGTGAATCAGGAAATCAT pLKO.1 1885 CDS 100% 5.625 7.875 N XYLT1 n/a
3 TRCN0000034882 GAGAGGCTATTCCGCAACTTT pLKO.1 2327 CDS 100% 5.625 7.875 N XYLT1 n/a
4 TRCN0000034879 CGAGGGTAAAGCCAACAAGAA pLKO.1 988 CDS 100% 4.950 6.930 N XYLT1 n/a
5 TRCN0000437027 CACGTGGACAAGCGCTCTAAT pLKO_005 1154 CDS 100% 13.200 10.560 N XYLT1 n/a
6 TRCN0000034883 CCGAGATATGAATTTCTTGAA pLKO.1 1405 CDS 100% 4.950 3.960 N XYLT1 n/a
7 TRCN0000431452 GAACCGGAGGTTTGTAGAATA pLKO_005 1573 CDS 100% 13.200 9.240 N XYLT1 n/a
8 TRCN0000439268 ATGACCAGTTGGTGGCGTTTC pLKO_005 1374 CDS 100% 6.000 4.200 N XYLT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023539.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.