Transcript: Human XM_017023671.1

PREDICTED: Homo sapiens partner and localizer of BRCA2 (PALB2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PALB2 (79728)
Length:
4591
CDS:
965..4294

Additional Resources:

NCBI RefSeq record:
XM_017023671.1
NBCI Gene record:
PALB2 (79728)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359392 ATATTGGGCCTCTTAGTATTT pLKO_005 4328 3UTR 100% 13.200 10.560 N PALB2 n/a
2 TRCN0000167646 GCTTATTTATCCTTGGATGAT pLKO.1 2705 CDS 100% 4.950 3.960 N PALB2 n/a
3 TRCN0000359391 ATTCCTAAGAAGACCTAATTT pLKO_005 1675 CDS 100% 15.000 10.500 N PALB2 n/a
4 TRCN0000220048 GGCCTTTCTTCATCCATATTA pLKO.1 3059 CDS 100% 15.000 10.500 N PALB2 n/a
5 TRCN0000359466 TCTGCTTGGTACTACTATTAT pLKO_005 4045 CDS 100% 15.000 10.500 N PALB2 n/a
6 TRCN0000220047 GACTTAGAAGAGGACCTTATT pLKO.1 2978 CDS 100% 13.200 9.240 N PALB2 n/a
7 TRCN0000167948 CCACTGATCTTGGATGTACAT pLKO.1 4449 3UTR 100% 4.950 3.465 N PALB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.