Transcript: Human XM_017023748.1

PREDICTED: Homo sapiens axin 1 (AXIN1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AXIN1 (8312)
Length:
1867
CDS:
256..1692

Additional Resources:

NCBI RefSeq record:
XM_017023748.1
NBCI Gene record:
AXIN1 (8312)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061799 CCGAAAGTACATTCTTGATAA pLKO.1 837 CDS 100% 13.200 9.240 N AXIN1 n/a
2 TRCN0000363587 CCGAAAGTACATTCTTGATAA pLKO_005 837 CDS 100% 13.200 9.240 N AXIN1 n/a
3 TRCN0000061801 GCAGAGAGTTCAGGTATGGAT pLKO.1 1268 CDS 100% 3.000 2.100 N AXIN1 n/a
4 TRCN0000327918 GCAGAGAGTTCAGGTATGGAT pLKO_005 1268 CDS 100% 3.000 2.100 N AXIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.