Transcript: Human XM_017023907.1

PREDICTED: Homo sapiens RAB11 family interacting protein 3 (RAB11FIP3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB11FIP3 (9727)
Length:
2316
CDS:
386..1945

Additional Resources:

NCBI RefSeq record:
XM_017023907.1
NBCI Gene record:
RAB11FIP3 (9727)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056477 GCAGGTGAAGGACTTAACTAA pLKO.1 1096 CDS 100% 5.625 7.875 N RAB11FIP3 n/a
2 TRCN0000056476 CACTTTGAGGACTACGGTGAA pLKO.1 1550 CDS 100% 4.050 5.670 N RAB11FIP3 n/a
3 TRCN0000421983 GGGATCACAGCCATCAGAAAC pLKO_005 1169 CDS 100% 10.800 7.560 N RAB11FIP3 n/a
4 TRCN0000056474 CATCCAGTTTGCTACGGTCTA pLKO.1 1066 CDS 100% 4.050 2.835 N RAB11FIP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.