Transcript: Human XM_017023944.1

PREDICTED: Homo sapiens putative uncharacterized protein LOC400499 (LOC400499), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC400499 (400499)
Length:
7790
CDS:
391..7416

Additional Resources:

NCBI RefSeq record:
XM_017023944.1
NBCI Gene record:
LOC400499 (400499)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140789 GCATCCATACGATGGCAAAGT pLKO.1 5052 CDS 100% 4.950 6.930 N LOC400499 n/a
2 TRCN0000122624 GATGCATCCATACGATGGCAA pLKO.1 5049 CDS 100% 2.640 3.696 N LOC400499 n/a
3 TRCN0000140624 GAGACTAGGGTTGTCCTGAAT pLKO.1 4957 CDS 100% 4.950 3.465 N LOC400499 n/a
4 TRCN0000139918 GAACAGCAACAAGAGGCATCT pLKO.1 4068 CDS 100% 4.050 2.835 N LOC400499 n/a
5 TRCN0000121803 GAGCAATCACTTCATGGAGTT pLKO.1 4131 CDS 100% 4.050 2.835 N LOC400499 n/a
6 TRCN0000140157 GCCAGACCTTCAAGAATGACT pLKO.1 4097 CDS 100% 3.000 2.100 N LOC400499 n/a
7 TRCN0000139397 CCTGGTTACTTGGAATCAGCA pLKO.1 5097 CDS 100% 2.640 1.848 N LOC400499 n/a
8 TRCN0000140098 GAGGCAAGACAGGACATTGTA pLKO.1 4824 CDS 100% 5.625 3.375 N LOC400499 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.