Transcript: Human XM_017024096.1

PREDICTED: Homo sapiens synergin gamma (SYNRG), transcript variant X21, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYNRG (11276)
Length:
4055
CDS:
142..3969

Additional Resources:

NCBI RefSeq record:
XM_017024096.1
NBCI Gene record:
SYNRG (11276)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054122 GCCGATAGTGTATCACCACTA pLKO.1 2170 CDS 100% 0.405 0.567 N SYNRG n/a
2 TRCN0000364819 CTCTGTCATGCAGCCTAATAT pLKO_005 300 CDS 100% 15.000 10.500 N SYNRG n/a
3 TRCN0000369686 GAACTTAGCAGACCTAGATAT pLKO_005 2280 CDS 100% 13.200 9.240 N SYNRG n/a
4 TRCN0000364818 TTGGTTCCAGATGCCTATAAG pLKO_005 1336 CDS 100% 13.200 9.240 N SYNRG n/a
5 TRCN0000054120 CCAGGCTTCTAGTGGTTTCAT pLKO.1 1749 CDS 100% 5.625 3.938 N SYNRG n/a
6 TRCN0000054121 CCTTTCAGAGACCGTTCCAAT pLKO.1 3721 CDS 100% 4.950 3.465 N SYNRG n/a
7 TRCN0000054118 GCAGCGAGAAACCATTGTCTT pLKO.1 2321 CDS 100% 4.950 3.465 N SYNRG n/a
8 TRCN0000054119 GCAGCCTAATATGCAAGGCAT pLKO.1 309 CDS 100% 2.640 1.848 N SYNRG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.