Transcript: Human XM_017024187.1

PREDICTED: Homo sapiens TBC1 domain family member 16 (TBC1D16), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D16 (125058)
Length:
10938
CDS:
791..2422

Additional Resources:

NCBI RefSeq record:
XM_017024187.1
NBCI Gene record:
TBC1D16 (125058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294216 ACAGAGCGTTCTGGCGTAATG pLKO_005 1548 CDS 100% 10.800 15.120 N TBC1D16 n/a
2 TRCN0000061891 GCGAAAGGAGTACTCTGAGAT pLKO.1 1492 CDS 100% 4.950 6.930 N TBC1D16 n/a
3 TRCN0000286829 GCGAAAGGAGTACTCTGAGAT pLKO_005 1492 CDS 100% 4.950 6.930 N TBC1D16 n/a
4 TRCN0000061888 GCTTGTAATGTTTATCCGTTT pLKO.1 3069 3UTR 100% 4.050 2.835 N TBC1D16 n/a
5 TRCN0000286831 GCTTGTAATGTTTATCCGTTT pLKO_005 3069 3UTR 100% 4.050 2.835 N TBC1D16 n/a
6 TRCN0000061890 GTGGAAATACTGCACCGAGAT pLKO.1 1155 CDS 100% 4.050 2.835 N TBC1D16 n/a
7 TRCN0000286830 GTGGAAATACTGCACCGAGAT pLKO_005 1155 CDS 100% 4.050 2.835 N TBC1D16 n/a
8 TRCN0000294217 ACAAGCTGCGGAAGGCCATTT pLKO_005 1362 CDS 100% 10.800 6.480 N TBC1D16 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6341 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.