Transcript: Human XM_017024273.1

PREDICTED: Homo sapiens rhomboid like 3 (RHBDL3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHBDL3 (162494)
Length:
4533
CDS:
19..1281

Additional Resources:

NCBI RefSeq record:
XM_017024273.1
NBCI Gene record:
RHBDL3 (162494)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024273.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048625 CCTGACATACATCTTCATGCA pLKO.1 636 CDS 100% 2.640 2.112 N RHBDL3 n/a
2 TRCN0000048624 CTGGGAACACAGGCTACATTA pLKO.1 137 CDS 100% 13.200 9.240 N RHBDL3 n/a
3 TRCN0000048623 CTTGAAGAACTCCCTGGTTTA pLKO.1 582 CDS 100% 10.800 7.560 N RHBDL3 n/a
4 TRCN0000048626 AGGCATGAAGTGCCAGTTCAA pLKO.1 784 CDS 100% 4.950 3.465 N RHBDL3 n/a
5 TRCN0000443674 GCTGTGGCCCTTATCTGTATG pLKO_005 818 CDS 100% 10.800 6.480 N RHBDL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024273.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.